it2051229 Longest Common Subsequence

Design and implement algorithms to solve the longest common subsequence problem. Be sure to include your own test cases.

S1 = ACCGGTCGACTGCGCGGAAGCCGGCCGAA
S2 = GTCGTTCGGAATGCCGTTGCTCTGTAAA
S3 = ATTGCATTGCATGGGCGCGATGCATTTGGTTAATTCCTCG
S4 = CTTGCTTAAATGTGCA

Compare each of the provided strings to each other and your test cases. Compare by pairs only, finding the LCS of the pair.

In the writeup be sure to consider your experiences with the problem and also consider the efficiency. Don't forget to review the programming assignments guidelines.

Here is a related YouTube video you might interesting "A Dynamic Programming Algorithm - Sequence Alignment - By Tim Roughgarden https://www.youtube.com/watch?v=fXfLU0QOfj8

Academic Honesty!

It is not our intention to break the school's academic policy. Posted solutions are meant to be used as a reference and should not be submitted as is. We are not held liable for any misuse of the solutions. Please see the frequently asked questions page for further questions and inquiries.

Kindly complete the form. Please provide a valid email address and we will get back to you within 24 hours. Payment is through PayPal, Buy me a Coffee or Cryptocurrency. We are a nonprofit organization however we need funds to keep this organization operating and to be able to complete our research and development projects.